INTRODUCTION:

A significant role is played by the microbial communities in maintaining an ecological balance in any of the ecosystem, thereby influencing people’s lives. Exploring the depth of microbial diversity and the wide range of varying environment inhabited by the microorganisms, there is a probability of obtaining microorganisms harnessing several novel and unique enzymes with better biochemical characteristics and can be exploited for industrial and commercial potential¹.

Enzymes are biomolecules with a dual property to catalyze a biological as well as chemical reaction without altering the equilibrium of the reaction. Enzymes are exploited commercially in several industries². The third largest group is represented by proteases, among the industrial enzymes, which accounts for approximately 60% of the total market sale of enzymes worldwide³.

Proteases belong to the class hydrolases enzymes that enable the cleaving of specific peptide bonds in their target proteins. Proteases play a pivot role in various metabolic processes viz. sporulation, cell differentiation, migration etc.

Per the presence of functional group at their active sites proteases have been categorized as aspartic proteases, cysteine proteases, glutamic proteases, metalloproteases, serine proteases, threonine proteases and asparagine peptide lyases^4-5. Proteases are gaining a considerable amount of attention in the field of biotechnology, leather and detergent industry, silver recovery and waste management and silver recovery sectors¹.

In this paper, we characterized a protease enzyme from soil samples of dairy industry waste site at Phagwara, region of the state of Punjab by culture dependent approach (enrichment approach) and its genomic analysis.

MATERIALS AND METHODS:

Collection of soil samples

Different soil samples were collected aseptically into sterile polythene zip lock bags using sterilized (autoclaved) tools from Phagwara region, (Punjab) in India. The samples were dried and stored at room temperature for subsequent use.

Isolation of micro-organisms:

0.5g of each soil sample was dissolved in distilled water. Serial dilution up to 10^-3 of each sample was prepared. 200µl of these dilutions was spread on LB agar plates along with 200µl of undiluted suspension and incubated the plates for 12 hours at 30°C overnight. Based on morphology obtained different colonies were picked up and further streaked on LB agar plates and incubated for 12 hours at 30°C.

Isolation of protease producers:

Enrichment technique was employed for the isolation of microbes producing protease. In 100ml of enrichment media (LB+skimmed milk 0.5%). 1g of soil was inoculated and incubated overnight at 30°C. The overnight grown culture was then spread on LB agar plate and grown overnight at 30°C. Based on morphology obtained, single colonies were identified and five different strains named SSTA1, SSTA2, SSTA3, SSTA4 and SSTA5 were isolated respectively.

Isolation of genomic DNA and Identification of the isolated microbial strain (SSTA2) by 16Sr DNA sequencing:

High molecular weight (HMW) genomic DNA from the selected strain encoded as (SSTA2) was isolated using enrichment method⁶. The culture was harvested and suspended in DNA extraction buffer consisting of [0.1M Tris-HCl [pH 8.0], 0.1 M sodium EDTA [pH8.0], 0.1M sodium phosphate [pH 8.0], 1.5 M NaCl, 1% CTAB] and lysozyme, proteinase K (10 mg/ml) and RNase were also added and the mixture was incubated for 30 mins at 37°C. Then, 10% SDS solution was added and incubated at 65°C for 2 hours with continuous gentle mixing after every 5 minutes. Supernatant after centrifugation for 10 mins at 6,000g was transferred into fresh centrifuge tubes. The crude DNA was extracted using chloroform:isoamyl alcohol (24:1) and precipitated with PEG and NaCl. The crude DNA obtained was washed with 80% ethanol, centrifuged, dried and dissolved in sterile nuclease-free water. The 16S rRNA gene was amplified from the isolated DNA by using universal primers 16SF (5’ CAGCAGCCGCGGTAATAC 3’) and 16SR (5' ACGAGCTGACGACAGCCATG 3’) respectively. The PCR reaction was as follows:

Table 1: Showing PCR reaction conditions

Temperature (˚C)	Time (min: sec)	Cycles
Initial denaturation: 94	03:00	×1
Final denaturation: 94	00:15	× 35
Annealing: 60	00:15
Initial extension: 72	00:30
Final extension: 72	05:00	×1
Hold: 4	∞

The amplicon was sent for sequencing at Yaazh Xenomics, Chennai.

Amplification and sequencing of the protease gene:

After 16S rRNA amplification the isolated HMW DNA was further amplified using protease specific degenerate primers DP1F (5’-GCNGTNATYGACACCGGCGTATA-3’) and DP1R (5’-NGGNGTNGCCATNGAT GTACCGCT-3’) with an approximate amplicon size of 1kb. The amplicon was sent for sequencing at (Yaazh Xenomics, Chennai). The amino acid sequence was deduced using the translate tool of EXPASY (http://web.expasy.org/translate/). The sequence was analyzed using the BLASTp tool of NCBI.

Screening of the strains for proteolytic activity:

The proteolytic activity of the five strains isolated was checked on 0.5% skimmed milk agar plates. Out of the five strains only SSTA2 showed positive for protease by the zone of hydrolysis. For localization 100µL of cell free extract and 200µL of supernant was tested for proteolytic activity by agar diffusion assay.

Biochemical characterization of protease enzyme (proSSTA2):

Influence of temperature and pH on proSSTA2:

The influence of temperature on proSSTA2 activity was studied by tyrosine standard curve using 1% casein as substrate. The substrate was incubated with the enzyme at different temperatures (10°C-90°C) for 30 minutes and the reaction supernatant was collected. Estimation of residual tyrosine was done by Lowry’s method. The optimum activity of proSSTA2 was seen at 50°C. Enzyme stability was studied by pre-incubating the enzyme with buffer at different temperatures (10°C-90°C) for one hour. Next, the substrate was added and the enzyme was incubated at 50^oC for 30 minutes. Maximum activity was observed at a pre-incubation temperature of 10°C. The enzyme retained more than 50% of the activity at 50°C.

Influence of pH on proSSTA2 activity:

The effect of pH on proSSTA2 was studied by incubating 100uL of 10mg/mL casein with enzyme at different pH (2-12). The reactions were carried out at 50°C and tyrosine production was estimated using Lowry’s method. The enzyme showed optimum activity at a pH 10.

Influence of metal ions on proSSTA2:

The influence of different metal ions (Ca²⁺,Mn²,Mg ²⁺, Fe ²⁺, Cu²⁺, Co²⁺, and Zn²⁺) on the activity proSSTA2 was determined by incubating the enzyme with the substrate (caesin) for 30 minutes at a concentration of 2mM and 5mM. Tyrosine estimation assay was used to determine the residual activity.

Influence of inhibitors, detergents and additives on proSSTA2:

The influence of detergents on the activity of proSSTA2 was studied in the presence of 20%SDS, 20% CTAB, Tween20, Tween80 and TritonX-100. The influence of inhibitors and reducing agents was determined spectrophotometrically in the presence of 1mM and 25mM PMSF, 8M Urea, 8M Guanidine-HCL and 30 % H ₂O₂.

Fig.1: Showing Agarose Gel Electrophoresis of genomic DNA and PCR-amplified protease gene. (from left to right): A. 0.8% Agarose gel showing wells containing genomic DNA from encoded SSTA1, SSTA2, SSTA3, SSTA4 and SSTA5 strains respectively; B: 1% Agarose gel showing protease gene amplified(1kb) from genomic DNA of strain SSTA2 (right), using protease specific degenerate primers

RESULTS:

DNA extraction and PCR amplification:

Reasonably good quality genomic DNA was obtained from encoded strain SSTA2 (Fig.1) The isolated DNA was checked for yield and purity spectrophotometrically. 16S rDNA gene fragments were amplified from the extracted DNA using universal 16S primers. Further, PCR amplification using degenerate protease primers was performed with the isolated genomic DNA. The amplicon showed a size of 1kb (Fig.1) matching with the expected size.

Fig.2: Primary and secondary screening for protease producing strains and enzyme (Left to right).A.Strains SSTA2 and SSTA3 as protease producers; B.0.5% skimmed milk plate showing zone of clearance for determining the enzyme to be intracellular (right)

Protease Screening:

The primary screening experiments for enzyme screening were repeated twice to establish the reproducibility of the results i.e. (formation of zone of clearance). Repeating the experiments confirmed that the strain produced protease enzyme. Secondary screening, using the supernatant and cell free extract was performed to determine the localization of the enzyme. Zone of clearance obtained confirmed the enzyme to be intracellular. (Fig.2).

Sequencing Analysis:

The sequences obtained were analyzed using bioinformatics tools. The 16S rDNA amplified sequence was analyzed using BLASTn tool of NCBI. The amplified sequence was 567 bases long and revealed the organism encoded as SSTA2 to be Bacillus mycoides (accession number EU647707.1). Further, the isolated DNA amplified using specific degenerate protease primers was sent for sequencing and the sequence homology was checked with BLASTp tool. Sequencing results showed that the protease was a member of the S8-S53 superfamily of proteases and showed 95.34% identity with protease from Sinorhizobacterium meliloti (WP_014990260.10).

Biochemical Characterization of proSSTA2:

Activity of the protease proSSTA2 from a Bacillus mycoides strain was studied at various temperatures (10-90°C). The optimum temperature for proSSTA2 activity was found to be at 50°C, which was stable up to 60°C and insignificant after 70°C (Fig. 3a, 3b). With respect to pH, the enzyme showed significant activity in the pH range from 7 to 12 with maximal activity at pH 10 (Fig.3c). At pH 12, the protease activity was still 75% or maxima, which clearly suggested an alkalophilic nature of the enzyme^10-11. The effect of metal ions, inhibitors and additives was also studied for the protease enzyme. At 5mM concentration Mn²⁺enhanced the activity by 4.2 folds, Mg²⁺and Ca²⁺ increased the activity at a concentration of 2mM, Fe³⁺ decreased the enzyme activity by 25.1% and Cu²⁺ decreased the activity by 67% (Fig. 3d). SDS at a concentration of 2% increased the activity of proSSTA2 by 44%. PMSF, an inhibitor of protease decreased the activity by 60% and 80% at concentrations of 1mM and 5mM respectively. (Fig.3e).

DISCUSSION:

Alkalophilic proteases possess several industrial applications in leather, detergents, pharmaceutical, silver recovery, chemical industries, food processing as well as waste treatment. These enzymes are used for developing good-quality value-added products involving methods of enzyme aided (partial) digestion⁷. The effects of growth temperature and media pH are critical factors affecting the bacterial growth and enzyme production^8-9. Therefore, activity of the alkaline protease proSSTA2 from a Bacillus mycoides strain was studied at various temperatures (10-90°C). The optimum temperature for enzyme activity was 50°C, which persisted up to 60°C (Fig. 3a, 3b). The enzyme was the most active at pH 10, but showed a broad range of pH (7-12) for significant activity, which implied alkalophilic nature of proSSTA2^10-11. Metal ions work as cofactors of many enzymes. These cations are known to protect the enzyme against denaturation due to the temperature and play an essential part in maintaining the active conformation of the enzyme at elevated temperatures¹². At 5mM concentration Mn²⁺enhanced the activity and Ca²⁺ increased the activity at a concentration of 2mM, Fe³⁺ decreased the enzyme activity by 25.1% and Cu²⁺ decreased the activity by 67%. The effect of inhibitors and additives was also studied for the protease enzyme.SDS at a concentration of 2% increased the activity of proSSTA2 PMSF, decreased the enzyme activity at concentrations of 1mM and 5mM respectively.

Hence, the purified enzyme could also be further explored for its commercial applications and for studying structural and functional properties of alkaline proteases.

ACKNOWLEDGEMENT:

The authors acknowledge Lovely Professional University for providing facilities to carry out the present study.

REFERENCES:

1. Gupta R, Beg Q, Lorenz P. Bacterial alkaline proteases: molecular approaches and industrial applications. Applied microbiology and biotechnology. 2002 Jun 1;5 9(1):15-32.

2. Kumar CG, Takagi H. Microbial alkaline proteases: from a bioindustrial viewpoint. Biotechnology advances. 1999 Dec 15; 17(7):561-94.

3. Rao MB, Tanksale AM, Ghatge MS, Deshpande VV. Molecular and biotechnological aspects of microbial proteases. Microbiology and molecular biology reviews. 1998 Sep 1; 62(3):597-635.

4. Hartley BS. Proteolytic enzymes. Annual review of biochemistry. 1960 Jul; 29(1):45-72.

5. Rawlings ND, Waller M, Barrett AJ, Bateman A. MEROPS: the database of proteolytic enzymes, their substrates and inhibitors. Nucleic acids research. 2014 Jan 1; 42(D1):D503-9.

6. Zhou J, Bruns MA, Tiedje JM. DNA recovery from soils of diverse composition. Applied and environmental microbiology. 1996 Feb 1; 62(2):316-22.

7. Ellaiah P, Srinivasulu B, Adinarayana K. A review on microbial alkaline proteases.2002

8. Pathak AP, Deshmukh KB. Alkaline protease production, extraction and characterization from alkaliphilic Bacillus licheniformis KBDL4: A Lonar soda lake isolate.

9. Srividya S, Mala M. Influence of process parameters on the production of detergent compatible alkaline protease by a newly isolated Bacillus sp. Y. Turkish Journal of Biology. 2011 Mar 21; 35(2):177-82.

10. Horikoshi K. Alkaliphiles: some applications of their products for biotechnology. Microbiology and molecular biology reviews. 1999 Dec 1; 63(4):735-50.

11. Horikoshi K, Antranikian G, Bull AT, Robb FT, Stetter KO, editors. Extremophiles Handbook, vol. 1 – 2. Berlin: Springer; 2011.

12. Manni L, Jellouli K, Agrebi R, Bayoudh A, Nasri M. Biochemical and molecular characterization of a novel calcium-dependent metalloprotease from Bacillus cereus SV1. Process Biochemistry. 2008 May 31; 43(5):522-30.

Received on 25.05.2017 Modified on 18.06.2017

Research J. Pharm. and Tech 2017; 10(10):3435-3438.

DOI: 10.5958/0974-360X.2017.00611.4